Articles
NANDINA MOSAIC VIRUS IS RELATED TO TWO OTHER POTEXVIRUSES
Article number
568_11
Pages
85 – 91
Language
English
Abstract
Plants of the dwarf nandina (Nandina domestica Thunb.), cv Fire Power, propagated in South Carolina appear to be uniformly infected with at least two viruses: Cucumber mosaic virus (CMV) and Nandina mosaic virus (NaMV). The viruses cause a range of symptoms including: line patterns, mosaics, and rugosity of the leaves.
The line patterns and mosaics are commonly anthocyanotic rather than chlorotic but the color expressed is dependent upon the time of year.
Inoculation to plants of Chenopodium quinoa Willd suggested the presence of the two viruses.
Locally inoculated leaves rapidly became necrotic and dropped from the plants.
Later, systemic symptoms developed.
Inoculation of C. quinoa using the systemically infected material resulted in chlorotic local lesions and systemic lesions that gradually coalesced.
PCR was used to confirm the presence of CMV in both the original nandinas and the fallen, necrotic, locally-infected leaves.
Total RNA was extracted from the systemically infected leaves of C. quinoa and used to synthesize cDNA using the 3′ RACE adapter primer 5’GGCCACGCGTCGACTAGTAC(T)17 3′(GIBCO BRL). PCR was completed using an upstream primer that had been designed to correspond to an area of the coat protein of the capillovirus Apple stem-grooving virus. A product much smaller than anticipated was amplified, cloned, and sequenced.
BLAST searches indicated that putative translations of the sequence from these clones showed a substantial degree of identity with the carboxy terminal of the coat protein of Plantago asiatica mosaic virus (PlAMV). Hydrangea ringspot virus (HRSV) is another potexvirus reported to infect woody ornamental species.
It infects only a limited number of hosts systemically and thus the virus is frequently purified from hydrangea.
Total RNA was extracted from hydrangea infected with HRSV and the approach described above, but using another upstream primer corresponding to a conserved region of the potexvirus coat protein, was used to produce clones for this virus.
BLAST searches again indicated that the fragment of the clones which corresponded to the carboxy terminal region of the coat protein was very similar to PlAMV and NaMV, however, there was little similarity between the 3′ UTR of HRSV and the other two viruses.
Work is under way to complete the sequence of the coat proteins for both NaMV and HRSV and to confirm the relationship between the 3 potexviruses.
In addition, PCR tests for the identification of these viruses in woody ornamentals species are being validated. cRNA probes for both NaMV and HRSV have been developed and the use of these in tissue blotting assays is being assessed.
The line patterns and mosaics are commonly anthocyanotic rather than chlorotic but the color expressed is dependent upon the time of year.
Inoculation to plants of Chenopodium quinoa Willd suggested the presence of the two viruses.
Locally inoculated leaves rapidly became necrotic and dropped from the plants.
Later, systemic symptoms developed.
Inoculation of C. quinoa using the systemically infected material resulted in chlorotic local lesions and systemic lesions that gradually coalesced.
PCR was used to confirm the presence of CMV in both the original nandinas and the fallen, necrotic, locally-infected leaves.
Total RNA was extracted from the systemically infected leaves of C. quinoa and used to synthesize cDNA using the 3′ RACE adapter primer 5’GGCCACGCGTCGACTAGTAC(T)17 3′(GIBCO BRL). PCR was completed using an upstream primer that had been designed to correspond to an area of the coat protein of the capillovirus Apple stem-grooving virus. A product much smaller than anticipated was amplified, cloned, and sequenced.
BLAST searches indicated that putative translations of the sequence from these clones showed a substantial degree of identity with the carboxy terminal of the coat protein of Plantago asiatica mosaic virus (PlAMV). Hydrangea ringspot virus (HRSV) is another potexvirus reported to infect woody ornamental species.
It infects only a limited number of hosts systemically and thus the virus is frequently purified from hydrangea.
Total RNA was extracted from hydrangea infected with HRSV and the approach described above, but using another upstream primer corresponding to a conserved region of the potexvirus coat protein, was used to produce clones for this virus.
BLAST searches again indicated that the fragment of the clones which corresponded to the carboxy terminal region of the coat protein was very similar to PlAMV and NaMV, however, there was little similarity between the 3′ UTR of HRSV and the other two viruses.
Work is under way to complete the sequence of the coat proteins for both NaMV and HRSV and to confirm the relationship between the 3 potexviruses.
In addition, PCR tests for the identification of these viruses in woody ornamentals species are being validated. cRNA probes for both NaMV and HRSV have been developed and the use of these in tissue blotting assays is being assessed.
Authors
P.L. Hughes, M.T. Zimmerman, S.W. Scott
Keywords
nandina, hydrangea, potexviruses, relationships
Online Articles (37)